Associated material
Related literature
Other articles by authors
Related articles/pages
Download to ...
Share this article
Email updates
Technical Note
A novel pair of inducible expression vectors for use in Methylobacterium extorquens
Lon M Chubiz, Jessica Purswani, Sean Michael Carroll and Chistopher J Marx*
Corresponding author:
Chistopher J Marx
Department of Organismic and Evolutionary Biology, Harvard University, 16 Divinity Ave., Cambridge, MA 02138, USA
Environmental Microbiology Group, Institute of Water Research, University of Granada, C/Ramón y Cajal no. 4, 18071 Granada, Spain
Faculty of Arts and Sciences Center for Systems Biology, Harvard University, Cambridge, MA, USA
For all author emails, please .
BMC Research Notes 2013, 6:183&
doi:10.00-6-183
The electronic version of this article is the complete one and can be found online at:
Received:11 December 2012
Accepted:27 March 2013
Published:6 May 2013
& 2013 Chubiz et al.; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Formula display:Abstract
Background
Due to the ever increasing use of diverse microbial taxa in basic research and industrial
settings, there is a growing need for genetic tools to alter the physiology of these
organisms. In particular, there is a dearth of inducible expression systems available
for bacteria outside commonly used γ-proteobacteria, such as Escherichia coli or Pseudomonas species. To this end, we have sought to develop a pair of inducible expression vectors
for use in the α-proteobacterium Methylobacterium extorquens, a model methylotroph.
We found that the P R promoter from rhizobial phage 16-3 was active in M. extorquens and engineered the promoter to be inducible by either p-isopropyl benzoate (cumate) or anhydrotetracycline. These hybrid promoters, P R/cmtO and P R/tetO, were found to have high levels of expression in M. extorquens with a regulatory range of 10-fold and 30-fold, respectively. Compared to an existing
cumate-inducible (10-fold range), high-level expression system for M. extorquens, P R/cmtO and P R/tetO have 33% of the maximal activity but were able to repress gene expression 3 and 8-fold
greater, respectively. Both promoters were observed to exhibit homogeneous, titratable
activation dynamics rather than on-off, switch-like behavior. The utility of these
promoters was further demonstrated by complementing loss of function of ftfL - essential for growth on methanol - where we show P R/tetO is capable of not only fully complementing function but also producing a conditional
null phenotype. These promoters have been incorporated into a broad-host-range backbone
allowing for potential use in a variety of bacterial hosts.
Conclusions
We have developed two novel expression systems for use in M. extorquens. The expression range of these vectors should allow for increased ability to explore
cellular physiology in M. extorquens. Further, the P R/tetO promoter is capable of producing conditional null phenotypes, previously unattainable
in M. extorquens. As both expression systems rely on the use of membrane permeable inducers, we suspect
these expression vectors will be useful for ectopic gene expression in numerous proteobacteria.
Background
As the amount of bacterial genome sequencing information continues to grow, the need
for broad-host-range, extensible genetic tools will become increasingly ubiquitous.
In particular, the capacity for heterologous gene expression in diverse microbial
taxa will be of paramount importance for numerous research goals, as well as industrial
and synthetic biological applications. To this end, we explored the use of two well-characterized
transcriptional repressors (TetR and CymR) in conjunction with a phage-derived promoter
(P R from phage 16-3) to produce a novel of set inducible expression vectors for use in
the facultative methylotroph Methylobacterium extorquens.
Methylotrophic bacteria are a ubiquitous group of microorganisms defined by their
capacity to utilize reduced single-carbon (C1) compounds as a sole source of energy and biomass. The facultatively methylotrophic,
α-proteobacterium Methylobacterium extorquens has been a model organism in the study of C1 metabolism for over 50 years. In the last decade, due in part to the development
of a repertoire of genetic tools [-]Methylobacterium species have become increasingly useful in the study of horizontally transferred
metabolic pathways [-] and microbial evolution [-]. Furthermore, in the past few years genome sequences have become available for eight
representatives within Methylobacterium[,]. While considerable progress has been made for genetic manipulation of M. extorquens, an area that remains underrepresented by comparison is the development of regulated
expression systems.
To date, only one regulated expression system has been demonstrated to be functional
in M. extorquens. Choi and coworkers constructed an inducible expression system utilizing the cumate
responsive transcriptional repressor, CymR, from Pseudomonas putida F1 and the strong P mxaF promoter that drives the expression of methanol dehydrogenase in M. extorquens[]. This hybrid system has been modified and utilized to test the fitness consequences
of gene expression levels of different formaldehyde oxidation enzymes in Methylobacterium[,]. While functional, this promoter-operator pairs are extremely “leaky”, wherein the
basal level of expression in non-inducing conditions is quite high []. This limitation makes heterologous gene expression exceedingly difficult, and hampers
the exploration of conditionally null phenotypes.
Building on these previous findings, we have employed an additional transcriptional
repressor, TetR, from the transposon Tn10. As the foundational member of the TetR-family of DNA binding proteins [], to whom CymR is also a member, TetR has been extensively studied yielding much data
on ligand binding, DNA binding kinetics, and operator site specificity []. In the absence of inducer, TetR and CymR bind tightly to their respective operator
sites (see Figure ), thereby inhibiting transcriptional initiation by RNA polymerase. Upon binding of
ligands such as tetracycline or anhydrotetracycline (a high-affinity ligand) in the
case of TetR, or cumate (p-isopropyl benzoate) with CymR, the affinity of TetR and CymR for their respective
operator sites is nearly abolished, allowing for transcription initiation to proceed.
Exploiting these characteristics, numerous studies have modified existing expression
systems to behave in a dose-dependent manner. In fact, TetR and related transcriptional
repressors have found use in numerous synthetic biology applications in bacteria,
archaea, and eukaryotes [,-].
Map of expression vectors and sequences of PR/cmtO and PR/tetO. (A) Vectors maps of pLC290 (cumate inducible) and pLC291 (aTc inducible) expression
vectors. The multiple cloning site contains a variety of common, single-cutting restriction
sites. oriT: RP4/RK2 transfer origin. trrnB: transcriptional terminator. trfA, oriV: RK2 (IncP) replication protein and origin. ColE1: High-copy replication origin for E. coli (B) Sequences for used for the P R/cmtO and P R/tetO hybrid promoters. Known RNA polymerase interaction sites (bold text) and engineered
operators (underlined) are indicated.
Here we describe the construction of two IncP-based, inducible expression vectors for use in M. extorquens, and possibly numerous other proteobacteria with minor modification. The novelty
of these vectors lies in their use of two separate transcriptional repressors, TetR
and CymR, along with a strong promoter from the rhizobial phage 16-3. We demonstrate
the utility of these vectors by showing that i) induction is dose-dependent, ii) induction
is continuous through time, and iii) the regulatory range of both systems exceeds
those currently available for M. extorquens. Collectively, these results supply researchers investigating M. extorquens, and likely numerous other proteobacteria, with two alternative systems to express
genes in traditional and synthetic biology applications.
Promoter design and rationale
During the process of selecting an appropriate promoter, we desired that the promoter
i) be sufficiently active in M. extorquens and ii) not be subject to regulation by native transcription factors. Based on these
two criteria, a natural source for such a promoter was from bacteriophage. Many bacteriophage
promoters have a wide host range and often have strong, constitutive activity in the
absence of their transcriptional control mechanisms. However, numerous well characterized
coliphage-derived promoters such as λ P L, λ P R, T5 P N25, T7 P A1 are weakly active or inactive in M. extorquens[]. To this end, we looked to other bacteriophage promoters that have been shown to
be active in α-proteobacteria. Based on this metric, we explored the use of promoters from the control
region of the rhizobial phage 16-3 (P L and P R). Phage 16-3 has been extensively examined with physiological and biochemical studies
in both its host, the α-proteobacterium Sinorhizobium meliloti, and Escherichia coli[,], suggesting that P L and P R may be functional in a variety of hosts. Additionally, the only transcriptional regulator
known to interact with P L and P R is the 16-3 C repressor [].
In a set of exploratory experiments, we found that P R was active in M. extorquens (data not shown). As we desired to construct inducible systems, we focused attention
to engineering P R derivatives containing operator sites for the CymR and TetR regulators (Figure ). The resulting hybrid promoters, P R/cmtO and P R/tetO, were found to produce the widest regulatory range without interfering with P R promoter activity. Interestingly, we found that placing the operators, specifically
tetO, throughout other regions of the promoter resulted in either loss of promoter repression
or activity (data not shown). This was a somewhat surprising result given the flexibility
of many other phage-derived systems to be manipulated with multiple repressor and
activator operator sites [,]. Collectively, these findings allowed us to engineer two inducible promoters with
similar maximal activity (Figure ).
Induction profiles of the PR/cmtO and PR/tetO promoters. Induction profiles of mCherry containing pLC290 and pLC291 derivatives (A) pJP18T and (B) pJP22T in M. extorquens PA1. Cell cultures were grown to mid-log phase and induced for 24 hrs prior to fluorescence
measurements. Fluorescence units are presented as arbitrary units (A.U.) and normalized
as described in Materials and Methods.
Activation of P R/cmtO and P R/tetO is dose-dependent
A desirable property for regulated expression systems is for levels of gene expression
from the promoter to be proportional to the concentration of inducer. In order to
explore the range of induction of P R/cmtO and P R/tetO, the promoters along with their respective regulatory proteins were introduced onto
broad-host-range plasmids (IncP compatibility group) to create the expression vectors pLC290 and pLC291 (Figure ). Since previous studies have demonstrated mCherry to be a sensitive measure of gene expression in M. extorquens[], we decided to use mCherry fluorescence as a metric of promoter activity. We placed
the red-fluorescent protein variant mCherry under the control of each promoter in pLC290 and pLC291 and introduced the resulting
vectors (pJP18T and pJP22T) into M. extorquens. To induce expression from P R/cmtO and P R/tetO, we supplied varied concentrations of cumate (Q) and anhydrotetracycline (aTc), respectively,
to M. extorquens cultures.
In general, both promoters were found to be responsive to concentrations of Q and
aTc that were in agreement with previous studies in M. extorquens or other organisms [,,]. The P R/cmtO promoter was observed to respond to a range of 0.1 to 5 ug/ml (0.6 to 30 uM) of Q
and the P R/tetO promoter from 0.1 to 25 ng/ml (0.2 nM to 50 nM) aTc. Interestingly, the induction
profile of P R/cmtO increased in a log-linear fashion over the entire concentration range, whereas P
R/tetO was observed to have a much more concave profile. In terms of regulatory range, P
R/cmtO and P R/tetO were observed to have 10-fold and 30-fold induction, respectively, with both promoters
having the same maximum absolute levels of expression (Figure ). Importantly, the basal level of expression from P R/cmtO was found to be approximately 3-fold higher than that of P R/tetO. Taken together, these data suggest that while P R/cmtO may be more tunable, P R/tetO serves as a superior expression system for genes requiring tight repression, such
as cytotoxic proteins. Also, we found that there was minimal cross-talk between the
CymR and TetR ligand specificity or promoter binding indicating these systems would
work independent of one another (pJP18T: 4.6 Uninduced/4.2 with aTc; pJP22T: 1.0 Uninduced/1.1
with Q; Grown in succinate).
Comparing the levels of gene expression and regulatory range of P R/cmtO and P R/tetO to the cumate inducible P mxaF promoter previously reported [,], we found that in M. extorquens these promoters achieve 33% of the maximal activity of P mxaF (the strongest known Methylobacterium promoter) and provide a greater degree of repression. Specifically, a cumate-inducible
P mxaFmCherry expression vector, pHC115m, yielded relative fluorescence values of 15.6 ± 1.5 (uninduced)
to 157.1 ± 3.7 (induced). While this 10-fold regulatory range was similar to P R/cmtO, the minimal and maximal expression from P R/cmtO were both 3-fold lower. By comparison, P R/tetO, with a 30-fold regulatory range, was able to repress expression 8-fold lower than
the P mxaF system with only a 3-fold difference in maximum expression. Collectively, these results
demonstrate that both P R/cmtO and P R/tetO provide improvement over previously explored systems. However, we do note that P
mxaF may remain a superior promoter in cases when high-level protein over-expression is
desired. Importantly, these hybrid promoters allow for more relevant exploration of
cellular physiology as their expression levels and ranges fall well within or above
native promoters in M. extorquens.
Maximal activation of P R/cmtO and P R/tetO is substrate dependent
An issue with many expression systems designed with host-derived promoters is the
possibility of interactions with native transcription factors. Specifically, the P
mxaF promoter is known to be more highly active in cells grown on methanol as opposed
to succinate [,]. To explore this possibility, with respect to P R/cmtO and P R/tetO, we cultured M. extorquens harboring pJP18T and pJP22T in media with either methanol or succinate as the sole
carbon source (Table ). We found that succinate grown cells possessed a nearly 2-fold increase in maximal
gene expression, compared to
effectively, the opposite behavior
seen with P mxaF. We suspect that this disparity in maximal expression may be due to an external factor,
such as different plasmid copy numbers, between methanol and succinate growth. Previously
reported XylE and β-galactosidase promoter probe vectors used in M. extorquens, such as pCM130 and pCM132 (plasmids with the same backbone as pLC290 and pLC291),
exhibit between 2 and 3-fold increases in background activity during succinate versus
methanol growth []. As pCM130 and pCM132 possess no promoter sequences upstream of their reporter genes,
the only likely variation that might exist is in plasmid copy number. Comparing these
findings to our own, where P R/cmtO and P R/tetO contain no host-related transcription factor binding sites, we see similar fold changes
in maximal expression suggesting that a similar mechanism may be affecting these expression
systems. Taken together, these data indicate that single-copy or chromosomally integrated
systems be used in situations where uniform expression is desired across substrates.
Growth substrate dependence on PR/cmtO
and PR/tetO activation
Induction of P R/cmtO and P R/tetO is continuous
A problematic feature of many expression systems, particularly those associated with
metabolic pathways, is that gene expression can exhibit phenotypic heterogeneity throughout
the population of cells, such as an on-off, switch-like behavior [-]. To explore this possibility, we grew M. extorquens strains bearing the mCherry expression vectors pJP18T and pJP22T to mid-log phase, induced cultures with either
Q or aTc, and measured the time course of individual-cell fluorescence by flow cytometry.
We found that over 8 hours of induction the induced populations activated transcription
in a uniform, continuous manner (Figure ). Though we did observe residual uninduced cells, we suspect this may be due to debris
introduced by our cell fixing method or possibly cells losing mCherry due to costly over-expression. These data demonstrate the utility of the P R/cmtO and P R/tetO expression systems in studying aspects of cellular physiology requiring uniform gene
expression.
Single-cell dynamics of P R/cmtO and PR/tetO activation. Histograms of relative fluorescence values for pJP18T (A) and pJP22T (B) harboring M. extorquens PA1 as determined by single-cell flow cytometry. Cultures were grown to mid-log phase
and induced with 5 ug/ml Q (A) or 25 ng/ml aTc (B). At times 0, 2, 4, 6, 8, and 24 hrs, cells were harvested and fixed in carbon-free
Hypho medium supplemented with 100 mg/ml streptomycin. The 8 and 24 hr time points
have nearly overlapping fluorescence distributions. Fluorescence units are presented
as arbitrary units (A.U.) and normalized as described in Materials and Methods.
Complementation and conditional null phenotypes using P R/tetO constructs
To examine the utility of these vectors for studying M. extorquens physiology, we complemented a gene encoding a key enzyme in methanol metabolism using
the PR/tetO-based plasmid pLC291. We chose to use utilize P R/tetO due to the tight induction properties we have observed using an mCherry reporter
and Table ). The product of ftfL (formate-tetrahydrofolate ligase) is required for the assimilation of formate into
biomass during one-carbon metabolism []. A disruption in ftfL results in a methanol minus growth phenotype. By complementing a ftfL knockouts using ftfL–expressing vectors under the control of P R/tetO, in the presence of aTc, we found that we could fully restore growth on methanol
(Figure ). Importantly, in the absence of aTc, we observed that we were able to produce a
complete null phenotype for ftfL (Figure ). To date, no expression system for M. extorquens has been capable of producing conditional null phenotypes. These results demonstrate
the utility of P R/tetO to study M. extorquens physiology and generate conditional null mutants regulated
Complementation and conditional null phenotype of ftfL. Images of methanol grown cultures of M. extorquens AM1 strains CM4103 in the presence (+) and absence (-) of 20 ug/ml aTc. Final OD(600
nm) values presented are after 72 hrs of growth at 30°C in 20 mM MeOH supplemented
Conclusions
To date, only a handful of expression systems exist for bacterial models outside E. coli and other closely related γ-proteobacteria. In an effort to expand the genetic toolkit available to researchers
working with M. extorquens, and presumably other proteobacteria, we have constructed a set of two inducible
expression vectors that utilize the CymR and TetR (cumate and tetracycline repressors)
in conjunction with the strong P R promoter from phage 16-3. The pLC290 and pLC291 vectors were found to provide uniform,
high-level expression in M. extorquens over a wide range of inducer concentrations. Importantly, compared to the only existing
inducible system for M. extorquens, we found that P R/cmtO and P R/tetO have 3 and 8-fold increases in repression, respectively. This provides a significant
improvement in the ability to explore M. extorquens cellular physiology. Further, as these promoters operate orthogonally to one another,
we believe these expression systems will easily work in concert within a single strain
to allow complex genetic engineering in a wider range of bacteria. For these reasons,
we believe these vectors and promoter systems will be of great use to the bacteriological
community in many research and industrial settings.
Availability of supporting information
The plasmid data supporting the results of this article are available in the AddGene
repository with identification numbers
Bacterial strains, medium, and growth conditions
All bacterial strains used in this work are derivatives of Escherichia coli NEB10 β (New England Biolabs), E. coli LC100 (F-rph-1 ilvG attλ::[spcRlacIQtetR]) [], Methylobacterium extorquens PA1 strain CM2730 (ΔcelABCD) [] or M. extorquens AM1. Growth of all strains, except E. coli, was performed in modified ’Hypho’ minimal medium as described by Chou and coworkers
[], with succinate at 5 mM or methanol at 20 mM. E. coli strains were cultured in Luria-Bertani broth as described by Miller [] or nutrient broth. Media was supplemented with kanamycin at 50 ug/ml or ampicillin
at 100 ug/ml to select for the presence of all plasmids. Inducers anhydrotetracycline
(aTc) and cumate-KOH (Q) were supplied at 25 ng/ml or 5 ug/ml from aqueous stocks,
respectively, unless otherwise indicated. Growth and gene expression experiments were
performed at 30°C using an automated growth system described by Delaney and coworkers
Plasmid and strain construction
Promoter designs were initially constructed and subsequently mutated in a pBluescript(SK-)
(Stratagene) backbone. Synthetic oligonucleotides CAACAACTTATACC ATGGCCTACAAAAAGGCAAACAATGGTACTTGAC
GACTCATCACAA and GTCCGTTCGTTACAATCTA CAACTACAATTGTTGTGATGAGTCGTCAAGTACC ATTG containing
the sequence for a 91 nt region encoding the P R promoter from the rhizobial phage 16-3. The oligonucleotides were annealed to form
a 91 bp dsDNA fragment, followed by PCR amplification with primers ATAGGGCCCCAACAACTTATACCATGGCC
TAC and ATAGGTACCGTCCGTTCGTTACAATCTA CAAC to introduce PspOMI and KpnI restriction sites. The resulting fragment was digested with PspOMI and KpnI and cloned into the respective sites in pBluescript(SK-) to form pLC265. TetR and
CymR operator sites (tetO and cmtO), were introduced at the distal end of P R in pLC265 using enzymatic inverse PCR (EI-PCR) [] using primers ATACGTCTCATCCCTATCAGTGA TAGAGAGTTGTAGATTGTAACGAACGGAC, ATAC GTCTCAGGGACGTCAAGTACCATTGTTTGCC,
AT ACGTCTCAACAAACAGACAATCTGGTCTGTTTGT GGTACCCAATTCGCCCTATAG, and ATACGTCTCA TTGTTTACAATCTACAACTACAATTGTTGTG
fol- lowed by BsmBI digestion and ligation to generate plasmids pLC271 (P R/tetO containing) and pLC277 (P R/cmtO containing).
The subsequent broad-host-range vectors were constructed using the expression vector
pHC115 [] as a template. A DNA region encoding Tn10tetR was PCR amplified from LC100 using primers ATAGCT AGCAGGGAGAGACCCCGAATGATGTCTAGATTAG
ATAAAAGTAAAGTG and ATAGGGCCCTTAAGACC CACTTTCACATTTAAG containing NheI and PspOMI restriction sites. The resulting product was digested and ligated into the NheI and PspOMI sites of pHC115, thereby replacing the cymR coding region with tetR to form pLC261. From pHC115 and pLC261, the P mxaF region was excised with PspOMI and KpnI and replaced with subcloned P R/cmtO and P R/tetO fragments from pLC277 and pLC271. To the resulting plasmids, a t rrnB terminator was PCR amplified from pHC01 [] using primers ACGCGAAATTCAAGCGC TAGGGCCAAGTTGGGTAACGCCAGGGTTTTCCC or ATGTGAAAGTGGGTCTTAAGGGCCAAGTTGG
GTAACGCCAGGGTTTTCCC and TGTAGGCCAT GGTATAAGTTGTTGGGATGCAAAAACGAGGCTAG TTTACC and cloned
into the PspOMI site, using the method of Gibson and coworkers [], to reduce transcriptional read-through into the P R/cmtO and P R/tetO promoter regions. Likewise a more comprehensive multiple cloning site was introduced
into the KpnI and EcoRI sites using annealed synthetic oligonucleotides GATAG GTACCTCTAGAAGATCTACGCGTACTAGTGCATG
CGAGCTCACCGGTGAATTCATAG and CTATGAAT TCACCGGTGAGCTCGCATGCACTAGTACGCGTAG ATCTTCTAGAGGTACCTATC
to produce the final expression vectors pLC290 and pLC291. The mCherry expression vectors pJP18T and pJP22T were created by subcloning a KpnI and EcoRI digestion product containing mCherry from pHC115m [] into the corresponding sites in pLC290 and pLC291, respectively. The vectors pLC290
(GenBank Accession KC296704) and pLC291 (GenBank Accession KC296705) are publically
available from the non-profit organization AddGene.org ( ).
Unmarked ftfL knockouts were generated by transforming the the Cre-recombinase expression plasmid
pCM157 [] into M. extorquens AM1 derivatives CM216K.1 [] generating strain CM2336 (ΔftfL::loxP). The ftfL omplementation vector was generated by subcloning a KpnI and EcoRI digestion product of a pHC115-based ftfL plasmid (SMC unpublished) into the corresponding sites of pLC291, creating plasmids
pSC54. The vector, pSC54, was introduced into CM2336 via triparental mating using
the helper plasmid pRK2073 [,], to produce strains CM4103 (ΔftfL::loxP/pSC54). Complementation was performed by inoculation of succinate grown CM4103 into
methanol minimal medium containing 0 ug/ml or 20 ug/ml aTc.
Fluorescence-based expression assays
Assays to measure levels of mCherry protein expression were performed as follows. For dose-dependent response curves,
M. extorquens strains harboring pJP18T or pJP22T were grown to saturation in 10 ml of Hypho-succinate
medium. These cultures were then diluted 1:200 in fresh medium, followed by 630 ul
aliquots being dispensed to clear, flat-bottom, 48-well microtiter plates (Costar).
Cultures were grown for 4 hrs on a plate shaking tower (Caliper) at 150 rpm in a 30°C
humidified room. After 4 hrs of growth, 10 ul of fresh medium containing Q or aTc
was added to supply Q and aTc at desired concentrations. Cultures were allowed to
continue growth for an additional 24 hrs prior to fluorescence (excitation 587 nm/emission
610 nm) and optical density (600 nm) measurements made using a Tecan Safire2 plate
reader. Relative fluorescence values reported are:
Relative fluorescence (A.U.)
Dynamic expression assays were conducted under similar conditions as above with the
following exceptions. Cells (200 ul of culture) were harvested after induction at
0, 2, 4, 6, 8, and 24 hrs. Culture samples were pelleted by centrifugation (6,000
xg) and resuspended in an equal volume of cold Hypho medium without succinate and supplemented
with 100 mg/ml streptomycin to inhibit mCherry translation. Fixed cells were kept on ice prior to fluorescence measurements made
using a BD LSR II Flow Cytometer. Flow cytometry data were then analyzed using the
BioConductor flowCore package in R []. Reported fluorescence values for flow cytometry are raw values from the BD LSR II
and were not correlated to those of the Tecan Safire2.
Competing interests
The authors (LMC, JP, SMC and CJM) declare no competing interests with respect to
the findings in this article.
Authors’ contributions
LMC and CJM were responsible for the conception and design of the study. LMC, JP,
and SMC constructed all vectors and conducted all growth and fluorescence measurement
experiments. LMC, SMC, and CJM drafted the manuscript. All authors read and approved
the final manuscript.
Acknowledgements
The authors would like to thank Dipti Nayak for testing preliminary versions of the
vectors and Joshua Michener for helpful comments during the drafting of the manuscript.
This work was supported by a grant from NIH (GM078209).
References
Lidstrom ME:
Development of improved versatile broad-host-range vectors for use in methylotrophs
and other Gram-negative bacteria. Microbiology 2001,
147(Pt 8):.
Lidstrom ME:
Development of an insertional expression vector system for Methylobacterium extorquens
AM1 and generation of null mutants lacking mtdA and/or fch. Microbiology 2004,
150(Pt 1):9-19.
Lidstrom ME:
Broad-host-range cre-lox system for antibiotic marker recycling in gram-negative bacteria. Biotechniques 2002,
Development of a broad-host-range sacB-based vector for unmarked allelic exchange. BMC Res Notes 2008,
Chistoserdova L,
Vorholt JA,
Thauer RK,
Lidstrom ME:
C1 transfer enzymes and coenzymes linking methylotrophic bacteria and methanogenic
Archaea. Science 1998,
281(5373):99-102.
Chistoserdova L,
Jenkins C,
Kalyuzhnaya MG,
Lapidus A,
Vorholt JA,
Staley JT,
Lidstrom ME:
The enigmatic planctomycetes may hold a key to the origins of methanogenesis and methylotrophy. Mol Biol Evol 2004,
Kalyuzhnaya MG,
Korotkova N,
Crowther G,
Lidstrom ME,
Chistoserdova L:
Analysis of gene islands involved in methanopterin-linked C1 transfer reactions reveals
new functions and provides evolutionary insights. J Bacteriol 2005,
Asymmetric, bimodal trade-offs during adaptation of Methylobacterium to distinct growth
substrates. Evolution 2009,
Delaney NF,
Diminishing returns epistasis among beneficial mutations decelerates adaptation. Science 2011,
332(6034):.
Berthet J,
Fast growth increases the selective advantage of a mutation arising recurrently during
evolution under metal limitation. PLoS Genet 2009,
5(9):e1000652.
Vuilleumier S,
Chistoserdova L,
Bringel F,
Gourion B,
Cruveiller S,
Gillett W,
Gruffaz C,
Hourcade E,
Mangenot S,
Nadalig T,
Peyraud R,
Robinson DG,
Saenampechek C,
Salvignol G,
Vallenet D,
Vorholt JA,
Weissenbach J,
Médigue C,
Lidstrom ME:
Methylobacterium genome sequences: a reference blueprint to investigate microbial
metabolism of C1 compounds from natural and industrial sources. PLoS One 2009,
4(5):e5584.
Bringel F,
Chistoserdova L,
Farhan Ul Haque M,
Fleischman DE,
Gruffaz C,
Jourand P,
Muller EEL,
Nadalig T,
Peyraud R,
Roselli S,
Goodwin LA,
Ivanova N,
Kyrpides N,
Médigue C,
Mikhailova N,
Stolyar S,
Vorholt JA,
Vuilleumier S:
Complete genome sequences of six strains of the genus Methylobacterium. J Bacteriol 2012,
Bourque D,
Mullick A,
Míguez CB:
Bestowing inducibility on the cloned methanol dehydrogenase promoter (PmxaF) of Methylobacterium
extorquens by applying regulatory elements of Pseudomonas putida F1. Appl Environ Microbiol 2006,
Optimization of gene expression through divergent mutational paths. Cell Rep 2012,
1(2):133-140.
Martinez-Gomez NC,
Marx CJ, Drummond D A:
Good codons, bad transcript: large reductions in gene expression and fitness arising
from synonymous variants in a key enzyme. Mol Biol Evol 2012.
Martínez-Bueno M,
Molina-Henares AJ,
Watanabe K,
Gallegos MT,
Brennan R,
The TetR family of transcriptional repressors. Microbiol Mol Biol Rev 2005,
69(2):326-356.
Mechanisms underlying expression of Tn 10 encoded tetracycline resistance. Annu Rev Microbiol 1994,
48:345-369.
Independent and tight regulation of transcriptional units in Escherichia coli via
the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res 1997,
The role of configuration and coupling in autoregulatory gene circuits. Mol Microbiol 2010,
75(2):513-527.
Mullick A,
Koutroumanis M,
Guilbault C,
Broussau S,
Malenfant F,
Bourget L,
Lamoureux L,
Pilotte A,
The cumate gene-switch: a system for regulated expression in mammalian cells. BMC Biotechnol 2006,
Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc Natl Acad Sci USA 1992,
Freundlieb S,
Müller G,
Transcriptional activation by tetracyclines in mammalian cells. Science 1995,
268(5218):.
Kulkarni G,
Metcalf WW:
New methods for tightly regulated gene expression and highly efficient chromosomal
integration of cloned genes for Methanosarcina species. Archaea 2008,
2(3):193-203.
Dallmann G,
Related repressor specificity of unrelated phages. Nature 1987,
300:398-401.
Ferenczi S,
Csiszovszki Z,
Binding sites of different geometries for the 16-3 phage repressor. Proc Natl Acad Sci U S A 2002,
Promoters largely determine the efficiency of repressor action. Proc Natl Acad Sci U S A 1988,
Fran?ois TL,
Bourque D,
Bourget L,
Groleau D,
Míguez CB:
Novel, versatile, and tightly regulated expression system for Escherichia coli strains. Appl Environ Microbiol 2010,
FitzGerald KA,
Lidstrom ME:
Identification of an upstream regulatory sequence that mediates the transcription
of mox genes in Methylobacterium extorquens AM1. Microbiology 2005,
151(Pt 11):.
Siegele DA,
Gene expression from plasmids containing the araBAD promoter at subsaturating inducer
concentrations represents mixed populations. Proc Natl Acad Sci U S A 1997,
Ozbudak EM,
Thattai M,
Shraiman BI,
Van Oudenaarden A:
Multistability in the lactose utilization network of Escherichia coli. Nature 2004,
427(6976):737-740.
Enzyme induction as an all-or-none phenomenon. Proc Natl Acad Sci U S A 1957,
43(7):553-566.
O’Brien BN,
Breezee J,
Lidstrom ME:
Novel methylotrophy genes of Methylobacterium extorquens AM1 identified by using transposon
mutagenesis including a putative dihydromethanopterin reductase. J Bacteriol 2003,
185(2):669-673.
Chubiz LM,
Computational design of orthogonal ribosomes. Nucleic Acids Res 2008,
Delaney NF,
Kaczmarek ME,
Swanson PK,
Development of an optimized medium, strain and high-throughput culturing methods for
Methylobacterium extorquens. PLoS One 2012,
8(4):e62957.
Miller JH: A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia
coli and Related Bacteria.
Cold Spring Harbor: Cold Spring Harbor Laboratory P
Delaney NF,
Echenique JIR,
Clarity: An open-source manager for laboratory automation. J Lab Autom 2012.
Stemmer WP,
Morris SK:
Enzymatic inverse PCR: a restriction site independent, single-fragment method for
high-efficiency, site-directed mutagenesis. Biotechniques 1992,
13(2):214-220.
Gibson DG,
Chuang RY,
Venter JC,
Hutchison CA 3rd,
Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 2009,
6(5):343-345.
Vorholt JA,
Lidstrom ME:
Purification of the formate-tetrahydrofolate ligase from Methylobacterium extorquens
AM1 and demonstration of its requirement for methylotrophic growth. J Bacteriol 2003,
Chistoserdov AY,
Chistoserdova LV,
McIntire WS,
Lidstrom ME:
Genetic organization of the mau gene cluster in Methylobacterium extorquens AM1: complete
nucleotide sequence and generation and characteristics of mau mutants. J Bacteriol 1994,
Figurski DH,
Helinski DR:
Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid
function provided in trans. Proc Natl Acad Sci USA 1979,
Brinkman RR,
Haaland P,
Spidlen J,
Gentleman R:
flowCore: a Bioconductor package for high throughput flow cytometry. BMC Bioinformatics 2009,
Sign up to receive new article alerts from BMC Research Notes