Flashtool is probably one of the most useful tools for Sony Xperia devices. It was started by Bin4ry from XDA back in the Xperia X10 days. Androxyde has since taken the lead, continuing to update and build the program with help from other devs such as DooMLoRD. It is an essential tool used to install new firmware versions using FTF firmware files.
The latest version of Flashtool (0.9.15.0) is now available to download from the . The update brings support for Sony’s new 2014 Xperia devices. So if you’re planning on buying any of the new devices, including the Xperia Z2, then you should download it now to get yourself ready.
Other posts you might like:
Pushbullet
Hottest Posts
Discussions
Latest Posts
Categories
Select Month
December 2015 &(45)
November 2015 &(51)
October 2015 &(76)
September 2015 &(103)
August 2015 &(71)
July 2015 &(84)
June 2015 &(88)
May 2015 &(97)
April 2015 &(56)
March 2015 &(86)
February 2015 &(68)
January 2015 &(52)
December 2014 &(55)
November 2014 &(66)
October 2014 &(93)
September 2014 &(81)
August 2014 &(72)
July 2014 &(120)
June 2014 &(90)
May 2014 &(103)
April 2014 &(104)
March 2014 &(111)
February 2014 &(108)
January 2014 &(113)
December 2013 &(64)
November 2013 &(43)
October 2013 &(62)
September 2013 &(91)
August 2013 &(77)
July 2013 &(75)
June 2013 &(79)
May 2013 &(73)
April 2013 &(72)
March 2013 &(90)
February 2013 &(82)
January 2013 &(93)
December 2012 &(58)
November 2012 &(43)
October 2012 &(67)
September 2012 &(85)
August 2012 &(93)
July 2012 &(85)
June 2012 &(74)
May 2012 &(63)
April 2012 &(55)
March 2012 &(64)
February 2012 &(67)
January 2012 &(80)
December 2011 &(71)
November 2011 &(38)
October 2011 &(46)
September 2011 &(64)
August 2011 &(35)
July 2011 &(30)
June 2011 &(32)
May 2011 &(29)
April 2011 &(66)
March 2011 &(59)
February 2011 &(41)
January 2011 &(35)
Subscribe for email updates
@roner70 Hopefully, just a mistake. Keep us posted, @roner70 If it's still in warranty then surely there should be no charge :?, @Milanpatel_08 If Sony changes its tune, we'll let you know, @VargaMateImre Agreed!, @KarimSarsar We have to agree - will be interesting to see what support it gets,Anglo Saxon Old English Dictionary.398 PagesJen Marie&&connect to downloadGet&pdfREAD PAPERAnglo Saxon Old English Dictionary.Loading Preview
Log In&with&FacebookLog In&with&GoogleEmail:Password:Remember me on this computeror&Enter the email address you signed up with and we'll email you a reset link.
Academia & 2015SAM tools / Mailing Lists
Mailing Lists
Brought to you by:
samtools-help
& bug report, feature request, troubleshooting and anything else
You can subscribe to this list .
results of 173
(Page 1 of 7)
I am using the following code to do SNP variants calling.
samtools mpileup -d 50000 -f FASTA -g BAMfile | bcftools view -vcg -& VCFfile
I want to eliminate the filter which removes reads with poor mapping quality.
Also I want to be able to adjust the filter for future analysis.
How would I go about doing this?
On 30 Apr 2012, at 10:12, Marian Thieme wrote:
& My question is: obviously the input data are not strictly queryname
& sorted. (Silly question by the way: should they when they are coming
& from the Illumina HiSeq ?)
If it's not documented as such, I wouldn't assume they would be.
If nothing else, to the extent that the components of the read names are coordinates, even if they appeared to be sorted there is much room for confusion about whether they're numerically or alphabetically sorted.
& But still at least readpairs are correctly
& grouped together. I think in this case a relaxed version of queryname
& order like some kind of 'readpair oder' would be helpful.
There is a way to represent this: "@HD GO:query", which is accepted by both samtools and Picard, but I don't think either of them do anything in particular with it.
This was described in earlier versions of the SAM/BAM spec as:
Group order (full sorting is not imposed in a group). Valid values are: none, query or reference.
but this text appears to have been dropped when the spec was TeXified.
I have been unable to find any explanation or discussion of this on the mailing lists.
It is often rather useful to bring read pair we have a tool, samgroupbyname, that does just this (and writes out a GO:query header) and does it much faster than a full sort could do.
Picard's SamToFastq does something similar to write pair-synchronised fastq files without fully sorting them.
The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.
Can someone please explain to me in more detail the consequences of applying -C50 to mpileup?
Specifically,
In the formula given in the documentation - sqrt((INT-q)/INT)*INT what is q? It is described as the phred-scaled probability of being generated from the mapped position. Is it 1-mapping quality once this is converted from the Phred scale?
Is this formula applied to all reads or only ones with "excessive" mismatches? And if so what is excessive mismatches? (I am working with 75 bp paired end reads). Can reads be excluded altogether as a result of -C50? I tried using it along with a mapping quality filter -q30 followed by bcftools but whilst MQ went down, all the reads were included (according to the depth i -q30 alone did remove some reads).
Thanks for any help
The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.
I am using picard api to process reads in sam format and output bam.
Since the input is usually produced by bwa I was thinking reads are
querynamed sorted.
Sometimes I need a queryname sorted bam for instance when doing read
pair traversal to output unmapped read pairs. For this reason I set
the header to queryname sortorder:
SAMFileHeader outHeader = inputSam.getFileHeader();
outHeader.setSortOrder(SortOrder.queryname);
It seems that this approach is suboptimal, since I have now a number
of projects, where lot of reads are discarded by the warning/error
like this:
Sort order is queryname. Offending records are at
[HWI-ST225:382:D0C7RACXX:1:94] and
[HWI-ST225:382:D0C7RACXX:1:07]
My question is: obviously the input data are not strictly queryname
sorted. (Silly question by the way: should they when they are coming
from the Illumina HiSeq ?)
But still at least readpairs are correctly
grouped together. I think in this case a relaxed version of queryname
order like some kind of 'readpair oder' would be helpful.
Any commens ?
At some point between 0.1.17 (r973:277) and the 0.1.18 (r982:295) and continuing to the latest version in github, the behaviour of samtools fixmate has changed and some alignments are now removed.
samtools-0.1.17 fixmate test.bam /dev/stdout | samtools view -c -
samtools-0.1.18 fixmate test.bam /dev/stdout | samtools view -c -
The first few lines of test.bam are below.
It appears that the alignments with RNAME '*' are now being dropped. Is this the expected behaviour? I guess the change came in with this commit ().
@HD VN:1.3 SO:queryname
@SQ SN:fake_chr1 LN:290640
@SQ SN:fake_chr2 LN:1716851
@RG ID:8324_8 LB:LIB03 SM:SAMPLE02 PI:200 CN:SC PL:ILLUMINA DS:STUDY01
@PG ID:bwa PN:bwa VN:0.5.9-r16
IL3_:44:560 77 * 0 0 * * 0 0 TCACACAAGTTTATACGCAAAATGCTGGTGATGGCTTGAAACGGCTTGTTGGACATCACGA ?@@&@7AA@=@??@:49;.7&@&=9&??)&;;=&3.99'78+35$$'$$)&+*3@@@AA@: RG:Z:8324_8
IL3_:44:560 141 * 0 0 * * 0 0 AGCAAGGTCAATTTCCTTGGGAGCAACGTTGTAGTCACCCGGTGCAAAAGACGG &@&@&@&@&93@@@@@&8&&;&&:798/4&&&;=0&2*6*/%.(11'&&%.&/9 RG:Z:8324_8
IL3_:44:1173 77 * 0 0 * * 0 0 AAGCCTGACGGTAGGCAGCACGGCTCTCTGGATTGCCAAGACTGTTGAGGTGGAATCACGC @&;:;;&AAA?.94=&=1&?&&&@0?6+/7,:';&@@@7) RG:Z:8324_8
IL3_:44: * 0 0 * * 0 0 TTCAAACAGCACAATTACGCTGAGATTCGCACACCAATATTTTATCATTACGAG ?B@&BB&,&4;':51.+':4B4&@B)B.'2-+0&B:+3'8B*6;*;?1++5-1- RG:Z:8324_8 XC:i:49
IL3_:44:1792 99 fake_chr1 M3S =
GCATTATCAAGCGTCGAACAGTTGCGAAGGAAGTTGCCGATAAAGGACGAATAACAGATCA @?@&?@?AAAAAA1&&=?&AA4@...&&?A&9=3&&&7?=16.976'//004;9A;A'''. RG:Z:8324_8 XC:i:58 XT:A:U NM:i:2 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:54A2T0
IL3_:44: fake_chr1 M =
AGAACGCCAACAAAAAAATCGTTTTATGGGTGCAATTCTTATTCTAGTTATCTT 1,=3@//13'331@;?33'?@@&1@...?&A@=@@&?A&B4:&38?033@...;?B@& RG:Z:8324_8 XT:A:U NM:i:1 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:39C14
IL3_:45:17 117 fake_chr1
TCGTGATTTGCCCTTCAAGCCCCTCAAATTCAGCTTCTTCCGTACCACCCACTCCATTCCA 2@=&A==)+)/;=/06;353/?&5=&&$$$753&9(&=&A;/7(@'$'&A2A=AAA=?AAA RG:Z:8324_8
IL3_:45:17 153 fake_chr1
ACGCGGTCTAGGTTTTCAACGAGGTAGGAGTAGTCGGGGATAACGTAGTCGATA *+,(28/+)0':&.*&1*+&1)%%0'&83&&)&'32;=&&4../7;?&7&=&59 RG:Z:8324_8 XC:i:36 XT:A:U NM:i:2 SM:i:25 AM:i:0 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:4T12T18
IL3_:45:30 117 fake_chr2
TACATCGCAATTCAGCAGTGTTCGGCACCCGACCTGTCGCATAGAGGACAGCGTCGAAAAT &&@@&@6++$$$$$$$+)+)1$%'2'$'531+433$$'125/;;&=&=??&& RG:Z:8324_8
IL3_:45:30 153 fake_chr2
TGGCGGTCCACAATTCACTTACCCATCCCTAGACGACTTCCGTATCGTTTTCGG */36,+,/1*6='7*%1&8:072;;7=98&=&&&6=&99&;=@? RG:Z:8324_8 XC:i:53 XT:A:U NM:i:1 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:21A31
IL3_:45:73 117 fake_chr2 54781 0 * = 54781 0 TCACTGTTCCTGAGCCAAGAGTTGTTGTGCAACTTGTGGATTGGCTTGTCCCTTGGTTGCT 19/A?&4-87-&79&&=;;??6A9:65:9@&?==@A@@=AAAA;@&;=@A? RG:Z:8324_8
IL3_:45:73 153 fake_chr2 M = 54781 0 ATAAATAGATATGTCAAAAGACTTCGATGATTTTTTACGAGAACATGAGGAGAA B=@&:*9&&A@...*=?&AB8'%'6A@...)7:@&@66342BB:&B?BA5BABBB?:? RG:Z:8324_8 XT:A:U NM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:54
IL3_:45:166 83 fake_chr2 S36M = 1 CAAGCTNGGCTGTGAACCCCTCACCCGTGCCTGGGTGGTGGAGCGTGAATTAGCAATCCAG $$$$$$$$1(5/'/1-'$'?-'$$$'=;-123'&8:A67&'$'=&A''''73;7'''A@&& RG:Z:8324_8 XC:i:36 XT:A:U NM:i:1 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:7T28
IL3_:45:166 163 fake_chr2 M6S =
AAAGCCATTGAAAGTGTTCTAAGCAATACCTTGCAAAACACAGTTGGGTTGGCG /376A=9&7@...&&0%.032&?&AA9@&A&&&@A;650@...??*&:323'/*.1(' RG:Z:8324_8 XC:i:48 XT:A:U NM:i:1 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:47T0
IL3_:45:204 99 fake_chr1
TTAGCCAGTTGGATAAACTCTTTGAGAAGATTGAGCTTTTTCCACATTTACAGGGGCTACA @@@@@@@@@ABBB&&??@?@@AA@?&9&@A@@@@?&@B?@@&:&=@@&&@?@8339A@=69 RG:Z:8324_8 XT:A:U NM:i:3 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:2 XO:i:1 XG:i:1 MD:Z:57C1C0
On Sun, Apr 29, 2012 at 9:11 PM, Mic &mictadlo@...& wrote:
& Hi Sean,
& I would like parse FASTA and FASTQ files and would like to
& keep library dependencies low. I thought to use BioJava, but maybe there is
& something else available?
Take a look at the SAM-JDK javadoc:
Both fasta and fastq are represented.
I haven't used them directly anytime
recently, though, to give you more direction.
& On Mon, Apr 30, 2012 at 4:20 AM, Sean Davis &sdavis2@...& wrote:
&& On Sun, Apr 29, 2012 at 10:44 AM, Mic &mictadlo@...& wrote:
&&& Hello,
&&& Is it possible to read/write fasta and fastq files with Picard tools?
&& Hi, Mic.
&& Perhaps you can clarify what it is you want to do.
The picard tools use
&& fasta and fastq as input, but I don't think that is what you meant.
I would like parse FASTA and FASTQ files and would like to
keep library dependencies low. I thought to use BioJava, but maybe there is
something else available?
On Mon, Apr 30, 2012 at 4:20 AM, Sean Davis &sdavis2@...& wrote:
& On Sun, Apr 29, 2012 at 10:44 AM, Mic &mictadlo@...& wrote:
&& Is it possible to read/write fasta and fastq files with Picard tools?
& Hi, Mic.
& Perhaps you can clarify what it is you want to do.
The picard tools use
& fasta and fastq as input, but I don't think that is what you meant.
As I said every now and then you learn something new...
was not aware of the '&(cmd)' redirection magic... seems to be bash
specific though.
To be able to reproduce your problem I had to remove the '| head'
otherwise worked fine.
On Sun, 29 Apr :05 -0500, Peng Yu &pengyu.ut@...& wrote:
& On Sun, Apr 29, 2012 at 9:43 AM, vrr &vrr@...& wrote:
&& To be honest, your commands are a quite obfuscating, what is that you
&& trying to achieve?
& I doesn't matter what I'm trying to achieve. The example is just to
& show the bug.
& The following command essentially let cmd1 and cmd2 take the same input.
& tee &(cmd1) &(cmd2) & input & /dev/null
& It should work as if you have the following command, when input is a
& cmd1 & input &
& cmd2 & input &
& When input is stdin, the above commands are not equivalent with the
& above one line tee command anymore.
& Since I have demonstrated both `tee &(samtools blah) & input` work
& correctly, one should expect `tee &(samtools blah) &(samtools blah) &
& input` also works. But it doesn't, which means that there is something
& in samtools to be fixed to match this expected behavior.
&& More concretely the redirection layout is very odd, I'm quite surprise
&& that actually works but you every-now and then you learn something new.
&& $ tee & (X_1) & (X_2) & input.bam & /dev/null
&& Do you mean instead ...
& It seems that you are not familiar with the usage of '&()'. You can
& look it up in bash manual.
&& $ tee & input.bam | (X_1) | (X_2) & /dev/null
&& If so, 'head' would truncate files along the way, so no surprise.
&& And if I am wrong... isn't it possible that you input files are
&& truncated, why must it be a bug?
&& On Fri, 27 Apr :31 -0500, Peng Yu &pengyu.ut@...&
&&& It seems that there is a bug in samtools. The commands are the
&&& ==============
&&& set -v
&&& tee &(samtools view -o /dev/stdout /dev/stdin | head) &(samtools view
&&& -H -o /dev/stdout /dev/stdin | head) & "$bamfile" & /dev/null
&&& tee &(samtools view -H -o /dev/stdout /dev/stdin | head) & "$bamfile"
&&&& /dev/null
&&& tee &(samtools view -o /dev/stdout /dev/stdin | head) & "$bamfile" &
&&& /dev/null
&&& ==========
&&& The output is the following. Notice the error message "[main_samview]
&&& truncated file." Could anybody familiar with the internal of samtools
&&& take a look what is wrong?
&&& The version is
&&& Program: samtools (Tools for alignments in the SAM format)
&&& Version: 0.1.17 (r973:277)
&&& ==============
&&& tee &(samtools view -o /dev/stdout /dev/stdin | head) &(samtools view
&&& -H -o /dev/stdout /dev/stdin | head) & "$bamfile" & /dev/null
&&& samtools view -o /dev/stdout /dev/stdin | head
&&& samtools view -H -o /dev/stdout /dev/stdin | head
SN:chr1 LN:
SN:chr2 LN:
SN:chr3 LN:
SN:chr4 LN:
SN:chr5 LN:
SN:chr6 LN:
SN:chr7 LN:
SN:chr8 LN:
SN:chr9 LN:
&&& [main_samview] truncated file.
&&& tee &(samtools view -H -o /dev/stdout /dev/stdin | head) & "$bamfile"
&&&& /dev/null
&&& samtools view -H -o /dev/stdout /dev/stdin | head
SN:chr1 LN:
SN:chr2 LN:
SN:chr3 LN:
SN:chr4 LN:
SN:chr5 LN:
SN:chr6 LN:
SN:chr7 LN:
SN:chr8 LN:
SN:chr9 LN:
&&& tee &(samtools view -o /dev/stdout /dev/stdin | head) & "$bamfile" &
&&& /dev/null
&&& samtools view -o /dev/stdout /dev/stdin | head
&& HWI-ST364_:#0
CCAGTTAGCAGGGGGAAAGCTTGTCAGACTTACTGTACACAGGCTCTTCCTGGCCAGGGAAAGGTGGAGGGAGTTGGGTCACCCCCATGCATGCTAGCTC
HHHHHHHHHHHHHHHHHHHHHHHHHHHFHHHHHHHHHHHHHFHBHCFHEFHHFHHHHHG@...&F6FDCDC9@&950B=AB?&?C9@...,A:
&& HWI-ST364_:#0
GTCAGAGCAGACCACAAGGCCAGGAACACCAAGCCCTGTCTATCTCAATTCTGCCCAGCTATAGGCTATAGGCATCTCTATTCACAAATCAGAAATAACT
HHHHHHGGHHHHFHGHHHHHEHHHHHHGHHHHFBHGHGFHHFFHH?EBGCEEGGGAA/DDGEED8ACDBDCGFGFFBF@...?%%%
&& HWI-ST364_:#0
ACTTGGGCCAACTGGGCCCTAAACCAACATAAAACTGCATCTTTGTCTTTCTAAATCCCTCAGCAAGCCCTCTAATTTACTATCCTCAAACACAAAGTTC
?FFFF@?@:@CBFFCDD=GEBCFFGDFFFFBDEEDDGFBFGEFFFGGGGBFDGFEBGFBDGGGGG@...
&& HWI-ST364_:#0
2S87M59811N11M
CAATAACACTTTTAGCACAACAAATTCCACAAGTTTAACCAGACAGTGAAATGTATGCTTTTATTACTCAAGGACAAATTGGATGTCACACTACATGCCC
%%%%%%%%%%%%%%%%@9EE=DDBC1=/::A.@...@9@...
&& HWI-ST364_:#0
2S84M12041N14M
CTCGGACCTTTGGAAGAGCAATCGGGTGCTCATACCCACTGAGCCATCTCACCAGCCCCAGTCTTCTGTTTTGTACTACCCAATTCAAACACAAGGTGGC
=7BE7;D@...:GBGEFE?FFCAFGBA@...@AF@...;HHHHHHHHHHHHHFHHHHHHHHHEHHEHHHHHHEGHHHHHHHHHHHHHH
&& HWI-ST364_:#0
AAAATAAAATGAAACCGCGTGCTGCCCATCTTTTCAAATAGTAAAAGAACCTTATGAAAAACCACTTGATTTTACAACAAAAGACACAAACGGACATTTT
HHHHHHHHHHHHHFHHHFHFHHHFHHCHHHGHHHHGHHHHHFGBGHGEHHHDHHHH:FDEFHFFHBFFDFEFDFFEGGGEHHGFHGFDHDHHHBEGFFGF
&& HWI-ST364_:#0
AAATGAAACCGCGTGCTGCCCATCTTTTCAAATAGTAAAAGAACCTTATGAAAAACCACTTGATTTTACAACAAAAGACACAAACGGACATTTTTATGTA
HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGHHFHHHGFGHHHHHHHHHHEHHHHHHHHHHHHHHHHFGGECGHHGGDBFD&EFFHEHHGHHHHHHGEH
&& HWI-ST364_:#0
CGAAACCGCGTGCTGCCCATCTTTTCAAATAGTAAAAGAACCTTATGAAAAACCACTTGATTTTACAACAAAAGACACAAACGGACATTTTTATGTAAAT
HHHHHHHGGHHHHHFGHHHGGHHHHGHEGHGEBGGHHHHGHHGHHEGDGEHGF?HHHHHGHHCHHDFGGFFE?GGGGEGDFEDGBGGGEGGGEGGGGHHH
&& HWI-ST364_:#0
GTGCTGCCCATCTTTTCAAATAGTAAAAGAACCTTATGAAAAACCACTTGATTTTACAACAAAAGACACAAACGGACATTTTTATGTAAATTTATAAGGC
EGDDDHC;HHHHHHHHFGHFEHEEGHHHHHHHGHHFHFDHHGHFHHGEHEHHHHGHGHHHHHFHHHHHHHHHFHGHHHHHGHHHHHHFHHDHHHHHHHHH
&& HWI-ST364_:#0
CCGCGCGCCCATCTTTTCAAATAGTAAAAGAACCTTATGAAAAACCACTTGATTTTACAACAAAAGACACAAACGGACATTAGATCGGAAGAGCGGTTCA
EHHEHHHHH@...=HHGHHGHHFFHH=HDGHFGHHGHDECFBACFFFFFDEDDB@...&EEE
&&& ===============================
The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.
The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.
On Sun, Apr 29, 2012 at 10:44 AM, Mic &mictadlo@...& wrote:
& Is it possible to read/write fasta and fastq files with Picard tools?
Perhaps you can clarify what it is you want to do.
The picard tools use
fasta and fastq as input, but I don't think that is what you meant.
On Sun, Apr 29, 2012 at 9:43 AM, vrr &vrr@...& wrote:
& To be honest, your commands are a quite obfuscating, what is that you are
& trying to achieve?
I doesn't matter what I'm trying to achieve. The example is just to
show the bug.
The following command essentially let cmd1 and cmd2 take the same input.
tee &(cmd1) &(cmd2) & input & /dev/null
It should work as if you have the following command, when input is a file.
cmd1 & input &
cmd2 & input &
When input is stdin, the above commands are not equivalent with the
above one line tee command anymore.
Since I have demonstrated both `tee &(samtools blah) & input` work
correctly, one should expect `tee &(samtools blah) &(samtools blah) &
input` also works. But it doesn't, which means that there is something
in samtools to be fixed to match this expected behavior.
& More concretely the redirection layout is very odd, I'm quite surprise if
& that actually works but you every-now and then you learn something new.
& $ tee & (X_1) & (X_2) & input.bam & /dev/null
& Do you mean instead ...
It seems that you are not familiar with the usage of '&()'. You can
look it up in bash manual.
& $ tee & input.bam | (X_1) | (X_2) & /dev/null
& If so, 'head' would truncate files along the way, so no surprise.
& And if I am wrong... isn't it possible that you input files are genuinely
& truncated, why must it be a bug?
& On Fri, 27 Apr :31 -0500, Peng Yu &pengyu.ut@...& wrote:
&& It seems that there is a bug in samtools. The commands are the following
&& ==============
&& tee &(samtools view -o /dev/stdout /dev/stdin | head) &(samtools view
&& -H -o /dev/stdout /dev/stdin | head) & "$bamfile" & /dev/null
&& tee &(samtools view -H -o /dev/stdout /dev/stdin | head) & "$bamfile"
&&& /dev/null
&& tee &(samtools view -o /dev/stdout /dev/stdin | head) & "$bamfile" &
&& /dev/null
&& ==========
&& The output is the following. Notice the error message "[main_samview]
&& truncated file." Could anybody familiar with the internal of samtools
&& take a look what is wrong?
&& The version is
&& Program: samtools (Tools for alignments in the SAM format)
&& Version: 0.1.17 (r973:277)
&& ==============
&& tee &(samtools view -o /dev/stdout /dev/stdin | head) &(samtools view
&& -H -o /dev/stdout /dev/stdin | head) & "$bamfile" & /dev/null
&& samtools view -o /dev/stdout /dev/stdin | head
&& samtools view -H -o /dev/stdout /dev/stdin | head
SN:chr1 LN:
SN:chr2 LN:
SN:chr3 LN:
SN:chr4 LN:
SN:chr5 LN:
SN:chr6 LN:
SN:chr7 LN:
SN:chr8 LN:
SN:chr9 LN:
&& [main_samview] truncated file.
&& tee &(samtools view -H -o /dev/stdout /dev/stdin | head) & "$bamfile"
&&& /dev/null
&& samtools view -H -o /dev/stdout /dev/stdin | head
SN:chr1 LN:
SN:chr2 LN:
SN:chr3 LN:
SN:chr4 LN:
SN:chr5 LN:
SN:chr6 LN:
SN:chr7 LN:
SN:chr8 LN:
SN:chr9 LN:
&& tee &(samtools view -o /dev/stdout /dev/stdin | head) & "$bamfile" &
&& /dev/null
&& samtools view -o /dev/stdout /dev/stdin | head
& HWI-ST364_:#0
CCAGTTAGCAGGGGGAAAGCTTGTCAGACTTACTGTACACAGGCTCTTCCTGGCCAGGGAAAGGTGGAGGGAGTTGGGTCACCCCCATGCATGCTAGCTC
HHHHHHHHHHHHHHHHHHHHHHHHHHHFHHHHHHHHHHHHHFHBHCFHEFHHFHHHHHG@...&F6FDCDC9@&950B=AB?&?C9@...,A:
& HWI-ST364_:#0
GTCAGAGCAGACCACAAGGCCAGGAACACCAAGCCCTGTCTATCTCAATTCTGCCCAGCTATAGGCTATAGGCATCTCTATTCACAAATCAGAAATAACT
HHHHHHGGHHHHFHGHHHHHEHHHHHHGHHHHFBHGHGFHHFFHH?EBGCEEGGGAA/DDGEED8ACDBDCGFGFFBF@...?%%%
& HWI-ST364_:#0
-212370 ACTTGGGCCAACTGGGCCCTAAACCAACATAAAACTGCATCTTTGTCTTTCTAAATCCCTCAGCAAGCCCTCTAATTTACTATCCTCAAACACAAAGTTC
?FFFF@?@:@CBFFCDD=GEBCFFGDFFFFBDEEDDGFBFGEFFFGGGGBFDGFEBGFBDGGGGG@...
& HWI-ST364_:#0
2S87M59811N11M
CAATAACACTTTTAGCACAACAAATTCCACAAGTTTAACCAGACAGTGAAATGTATGCTTTTATTACTCAAGGACAAATTGGATGTCACACTACATGCCC
%%%%%%%%%%%%%%%%@9EE=DDBC1=/::A.@...@9@...
& HWI-ST364_:#0
2S84M12041N14M
CTCGGACCTTTGGAAGAGCAATCGGGTGCTCATACCCACTGAGCCATCTCACCAGCCCCAGTCTTCTGTTTTGTACTACCCAATTCAAACACAAGGTGGC
=7BE7;D@...:GBGEFE?FFCAFGBA@...@AF@...;HHHHHHHHHHHHHFHHHHHHHHHEHHEHHHHHHEGHHHHHHHHHHHHHH
& HWI-ST364_:#0
AAAATAAAATGAAACCGCGTGCTGCCCATCTTTTCAAATAGTAAAAGAACCTTATGAAAAACCACTTGATTTTACAACAAAAGACACAAACGGACATTTT
HHHHHHHHHHHHHFHHHFHFHHHFHHCHHHGHHHHGHHHHHFGBGHGEHHHDHHHH:FDEFHFFHBFFDFEFDFFEGGGEHHGFHGFDHDHHHBEGFFGF
& HWI-ST364_:#0
AAATGAAACCGCGTGCTGCCCATCTTTTCAAATAGTAAAAGAACCTTATGAAAAACCACTTGATTTTACAACAAAAGACACAAACGGACATTTTTATGTA
HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGHHFHHHGFGHHHHHHHHHHEHHHHHHHHHHHHHHHHFGGECGHHGGDBFD&EFFHEHHGHHHHHHGEH
& HWI-ST364_:#0
CGAAACCGCGTGCTGCCCATCTTTTCAAATAGTAAAAGAACCTTATGAAAAACCACTTGATTTTACAACAAAAGACACAAACGGACATTTTTATGTAAAT
HHHHHHHGGHHHHHFGHHHGGHHHHGHEGHGEBGGHHHHGHHGHHEGDGEHGF?HHHHHGHHCHHDFGGFFE?GGGGEGDFEDGBGGGEGGGEGGGGHHH
& HWI-ST364_:#0
GTGCTGCCCATCTTTTCAAATAGTAAAAGAACCTTATGAAAAACCACTTGATTTTACAACAAAAGACACAAACGGACATTTTTATGTAAATTTATAAGGC
EGDDDHC;HHHHHHHHFGHFEHEEGHHHHHHHGHHFHFDHHGHFHHGEHEHHHHGHGHHHHHFHHHHHHHHHFHGHHHHHGHHHHHHFHHDHHHHHHHHH
& HWI-ST364_:#0
CCGCGCGCCCATCTTTTCAAATAGTAAAAGAACCTTATGAAAAACCACTTGATTTTACAACAAAAGACACAAACGGACATTAGATCGGAAGAGCGGTTCA
EHHEHHHHH@...=HHGHHGHHFFHH=HDGHFGHHGHDECFBACFFFFFDEDDB@...&EEE
&& ===============================
The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.
Is it possible to read/write fasta and fastq files with Picard tools?
Thank you in advance.
I see now. Let me say it explicitly for posterity:
1) Alignment via bwa aln involves two steps.
These steps are bwa aln plus either bwa samse or bwa sampe.
2) Alignment via bwa bwasw involves only one step.
This step is, obviously, bwa bwasw.
Thank you Heng and Joe.
Ivan Gregoretti, PhD
On Sat, Apr 28, 2012 at 2:53 PM, Heng Li &lh3@...& wrote:
& bwasw output sam
& On Apr 28, 2012, at 2:11 PM, Ivan Gregoretti wrote:
&& Hello Joe,
&& It seems that you were right, or partially right at least.
&& I deleted all the mouse.mm9.fasta.* files, indexed with bwa 0.6.1 and
&& re run bwa bwasw. This time it worked but, alas! a new error arose
&& bwa samse mouse.mm9.fasta myfile.sai myfile.fq.gz
&& [bns_restore_core] fail to open file 'mouse.mm9.fasta.nt.ann'. Abort!
&& Aborted (core dumped)
&& Well, the error is true, bwa indexing generated mouse.mm9.fasta.ann,
&& not mouse.mm9.fasta.nt.ann. So, mouse.mm9.fasta.nt.ann does not exist.
&& I tried renaming mouse.mm9.fasta.nt.ann to mouse.mm9.fasta.ann
&& followed by bwa samse but it only ends in segmentation fault.
&& Any thoughts?
&& Thank you,
&& Ivan Gregoretti, PhD
&& On Fri, Apr 27, 2012 at 3:17 PM, Joseph Fass &joseph.fass@...& wrote:
&&& That can't be the meaning of that error message - bwasw has no requirement
&&& about uniform read lengths. It looks more like there's an issue with the
&&& indexing of the reference, and there was indeed a major change in the
&&& reference indexing between the 0.5 and 0.6 versions. I'm guessing that you
&&& indexed the reference with 0.5.9, since the alignment is working with that
&&& version. Try moving or removing all the mouse.mm9.fasta.* files,
&&& re-indexing, and re-trying the command.
&&& On Fri, Apr 27, 2012 at 11:23 AM, Ivan Gregoretti &ivangreg@...&
&&& wrote:
&&&& Hello everybody,
&&&& BWA seems to have introduced a bug in version 0.6.1
&&&& This is how I get it shown:
&&&& /bwa-0.6.1/bwa bwasw -t 4 mouse.mm9.fasta myfile.fq.gz & myfile.sai
&&&& [bwt_restore_sa] SA-BWT inconsistency: seq_len is not the same. Abort!
&&&& Aborted
&&&& I am currently running successfully the exact same command with version
&&&& 0.5.9.
&&&& I interpret the error message as saying that the input sequences have
&&&& different lengths. I checked, all sequences are 76 nucleotides long.
&&&& Am I the only one seeing this?
&&&& Thank you,
&&&& Ivan Gregoretti, PhD
&&&& ------------------------------------------------------------------------------
&&&& Live Security Virtual Conference
&&&& Exclusive live event will cover all the ways today's security and
&&&& threat landscape has changed and how IT managers can respond. Discussions
&&&& will include endpoint security, mobile security and the latest in malware
&&&& threats.
&&&& _______________________________________________
&&&& Samtools-help mailing list
&&&& Samtools-help@...
&&& Joseph Fass
&&& Lead Data Analyst
&&& UC Davis Bioinformatics Core
&&& joseph.fass -at-
&&& 530.752.2698 (w)
&& ------------------------------------------------------------------------------
&& Live Security Virtual Conference
&& Exclusive live event will cover all the ways today's security and
&& threat landscape has changed and how IT managers can respond. Discussions
&& will include endpoint security, mobile security and the latest in malware
&& threats.
&& _______________________________________________
&& Samtools-help mailing list
&& Samtools-help@...
The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.
bwasw output sam
On Apr 28, 2012, at 2:11 PM, Ivan Gregoretti wrote:
& Hello Joe,
& It seems that you were right, or partially right at least.
& I deleted all the mouse.mm9.fasta.* files, indexed with bwa 0.6.1 and
& re run bwa bwasw. This time it worked but, alas! a new error arose
& bwa samse mouse.mm9.fasta myfile.sai myfile.fq.gz
& [bns_restore_core] fail to open file 'mouse.mm9.fasta.nt.ann'. Abort!
& Aborted (core dumped)
& Well, the error is true, bwa indexing generated mouse.mm9.fasta.ann,
& not mouse.mm9.fasta.nt.ann. So, mouse.mm9.fasta.nt.ann does not exist.
& I tried renaming mouse.mm9.fasta.nt.ann to mouse.mm9.fasta.ann
& followed by bwa samse but it only ends in segmentation fault.
& Any thoughts?
& Thank you,
& Ivan Gregoretti, PhD
& On Fri, Apr 27, 2012 at 3:17 PM, Joseph Fass &joseph.fass@...& wrote:
&& That can't be the meaning of that error message - bwasw has no requirement
&& about uniform read lengths. It looks more like there's an issue with the
&& indexing of the reference, and there was indeed a major change in the
&& reference indexing between the 0.5 and 0.6 versions. I'm guessing that you
&& indexed the reference with 0.5.9, since the alignment is working with that
&& version. Try moving or removing all the mouse.mm9.fasta.* files,
&& re-indexing, and re-trying the command.
&& On Fri, Apr 27, 2012 at 11:23 AM, Ivan Gregoretti &ivangreg@...&
&&& Hello everybody,
&&& BWA seems to have introduced a bug in version 0.6.1
&&& This is how I get it shown:
&&& /bwa-0.6.1/bwa bwasw -t 4 mouse.mm9.fasta myfile.fq.gz & myfile.sai
&&& [bwt_restore_sa] SA-BWT inconsistency: seq_len is not the same. Abort!
&&& Aborted
&&& I am currently running successfully the exact same command with version
&&& 0.5.9.
&&& I interpret the error message as saying that the input sequences have
&&& different lengths. I checked, all sequences are 76 nucleotides long.
&&& Am I the only one seeing this?
&&& Thank you,
&&& Ivan Gregoretti, PhD
&&& ------------------------------------------------------------------------------
&&& Live Security Virtual Conference
&&& Exclusive live event will cover all the ways today's security and
&&& threat landscape has changed and how IT managers can respond. Discussions
&&& will include endpoint security, mobile security and the latest in malware
&&& threats.
&&& _______________________________________________
&&& Samtools-help mailing list
&&& Samtools-help@...
&& Joseph Fass
&& Lead Data Analyst
&& UC Davis Bioinformatics Core
&& joseph.fass -at-
&& 530.752.2698 (w)
& ------------------------------------------------------------------------------
& Live Security Virtual Conference
& Exclusive live event will cover all the ways today's security and
& threat landscape has changed and how IT managers can respond. Discussions
& will include endpoint security, mobile security and the latest in malware
& threats.
& _______________________________________________
& Samtools-help mailing list
& Samtools-help@...
The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.
Perhaps I should add that I am running linux 64bit and that the
version of bwa being used is 0.6.1-r104.
Ivan Gregoretti, PhD
On Sat, Apr 28, 2012 at 2:11 PM, Ivan Gregoretti &ivangreg@...& wrote:
& Hello Joe,
& It seems that you were right, or partially right at least.
& I deleted all the mouse.mm9.fasta.* files, indexed with bwa 0.6.1 and
& re run bwa bwasw. This time it worked but, alas! a new error arose
& bwa samse mouse.mm9.fasta myfile.sai myfile.fq.gz
& [bns_restore_core] fail to open file 'mouse.mm9.fasta.nt.ann'. Abort!
& Aborted (core dumped)
& Well, the error is true, bwa indexing generated mouse.mm9.fasta.ann,
& not mouse.mm9.fasta.nt.ann. So, mouse.mm9.fasta.nt.ann does not exist.
& I tried renaming mouse.mm9.fasta.nt.ann to mouse.mm9.fasta.ann
& followed by bwa samse but it only ends in segmentation fault.
& Any thoughts?
& Thank you,
& Ivan Gregoretti, PhD
& On Fri, Apr 27, 2012 at 3:17 PM, Joseph Fass &joseph.fass@...& wrote:
&& That can't be the meaning of that error message - bwasw has no requirement
&& about uniform read lengths. It looks more like there's an issue with the
&& indexing of the reference, and there was indeed a major change in the
&& reference indexing between the 0.5 and 0.6 versions. I'm guessing that you
&& indexed the reference with 0.5.9, since the alignment is working with that
&& version. Try moving or removing all the mouse.mm9.fasta.* files,
&& re-indexing, and re-trying the command.
&& On Fri, Apr 27, 2012 at 11:23 AM, Ivan Gregoretti &ivangreg@...&
&&& Hello everybody,
&&& BWA seems to have introduced a bug in version 0.6.1
&&& This is how I get it shown:
&&& /bwa-0.6.1/bwa bwasw -t 4 mouse.mm9.fasta myfile.fq.gz & myfile.sai
&&& [bwt_restore_sa] SA-BWT inconsistency: seq_len is not the same. Abort!
&&& Aborted
&&& I am currently running successfully the exact same command with version
&&& 0.5.9.
&&& I interpret the error message as saying that the input sequences have
&&& different lengths. I checked, all sequences are 76 nucleotides long.
&&& Am I the only one seeing this?
&&& Thank you,
&&& Ivan Gregoretti, PhD
&&& ------------------------------------------------------------------------------
&&& Live Security Virtual Conference
&&& Exclusive live event will cover all the ways today's security and
&&& threat landscape has changed and how IT managers can respond. Discussions
&&& will include endpoint security, mobile security and the latest in malware
&&& threats.
&&& _______________________________________________
&&& Samtools-help mailing list
&&& Samtools-help@...
&& Joseph Fass
&& Lead Data Analyst
&& UC Davis Bioinformatics Core
&& joseph.fass -at-
&& 530.752.2698 (w)
Hello Joe,
It seems that you were right, or partially right at least.
I deleted all the mouse.mm9.fasta.* files, indexed with bwa 0.6.1 and
re run bwa bwasw. This time it worked but, alas! a new error arose
bwa samse mouse.mm9.fasta myfile.sai myfile.fq.gz
[bns_restore_core] fail to open file 'mouse.mm9.fasta.nt.ann'. Abort!
Aborted (core dumped)
Well, the error is true, bwa indexing generated mouse.mm9.fasta.ann,
not mouse.mm9.fasta.nt.ann. So, mouse.mm9.fasta.nt.ann does not exist.
I tried renaming mouse.mm9.fasta.nt.ann to mouse.mm9.fasta.ann
followed by bwa samse but it only ends in segmentation fault.
Any thoughts?
Thank you,
Ivan Gregoretti, PhD
On Fri, Apr 27, 2012 at 3:17 PM, Joseph Fass &joseph.fass@...& wrote:
& That can't be the meaning of that error message - bwasw has no requirement
& about uniform read lengths. It looks more like there's an issue with the
& indexing of the reference, and there was indeed a major change in the
& reference indexing between the 0.5 and 0.6 versions. I'm guessing that you
& indexed the reference with 0.5.9, since the alignment is working with that
& version. Try moving or removing all the mouse.mm9.fasta.* files,
& re-indexing, and re-trying the command.
& On Fri, Apr 27, 2012 at 11:23 AM, Ivan Gregoretti &ivangreg@...&
&& Hello everybody,
&& BWA seems to have introduced a bug in version 0.6.1
&& This is how I get it shown:
&& /bwa-0.6.1/bwa bwasw -t 4 mouse.mm9.fasta myfile.fq.gz & myfile.sai
&& [bwt_restore_sa] SA-BWT inconsistency: seq_len is not the same. Abort!
&& Aborted
&& I am currently running successfully the exact same command with version
&& I interpret the error message as saying that the input sequences have
&& different lengths. I checked, all sequences are 76 nucleotides long.
&& Am I the only one seeing this?
&& Thank you,
&& Ivan Gregoretti, PhD
&& ------------------------------------------------------------------------------
&& Live Security Virtual Conference
&& Exclusive live event will cover all the ways today's security and
&& threat landscape has changed and how IT managers can respond. Discussions
&& will include endpoint security, mobile security and the latest in malware
&& threats.
&& _______________________________________________
&& Samtools-help mailing list
&& Samtools-help@...
& Joseph Fass
& Lead Data Analyst
& UC Davis Bioinformatics Core
& joseph.fass -at-
& 530.752.2698 (w)
On Thu, Apr 26, 2012 at 8:03 PM, 江JWK &biology0046@...& wrote:
& does vcfutils.pl contain opinions to filtered out snps clustered in 10 bp
& windows,
& I want to get only SNPs at least 10 bp apart.
Aren't these the same thing? I.e. if you *filter out* SNPs that are within
10 bp of another SNP, what you should be left with are SNPs that are at
least 10 bp away from any other SNP.
& ------------------------------------------------------------------------------
& Live Security Virtual Conference
& Exclusive live event will cover all the ways today's security and
& threat landscape has changed and how IT managers can respond. Discussions
& will include endpoint security, mobile security and the latest in malware
& threats.
& _______________________________________________
& Samtools-help mailing list
& Samtools-help@...
Joseph Fass
Lead Data Analyst
UC Davis Bioinformatics Core
joseph.fass -at-
530.752.2698 (w)
That can't be the meaning of that error message - bwasw has no requirement
about uniform read lengths. It looks more like there's an issue with the
indexing of the reference, and there was indeed a major change in the
reference indexing between the 0.5 and 0.6 versions. I'm guessing that you
indexed the reference with 0.5.9, since the alignment is working with that
version. Try moving or removing all the mouse.mm9.fasta.* files,
re-indexing, and re-trying the command.
On Fri, Apr 27, 2012 at 11:23 AM, Ivan Gregoretti &ivangreg@...&wrote:
& Hello everybody,
& BWA seems to have introduced a bug in version 0.6.1
& This is how I get it shown:
& /bwa-0.6.1/bwa bwasw -t 4 mouse.mm9.fasta myfile.fq.gz & myfile.sai
& [bwt_restore_sa] SA-BWT inconsistency: seq_len is not the same. Abort!
& I am currently running successfully the exact same command with version
& I interpret the error message as saying that the input sequences have
& different lengths. I checked, all sequences are 76 nucleotides long.
& Am I the only one seeing this?
& Thank you,
& Ivan Gregoretti, PhD
& ------------------------------------------------------------------------------
& Live Security Virtual Conference
& Exclusive live event will cover all the ways today's security and
& threat landscape has changed and how IT managers can respond. Discussions
& will include endpoint security, mobile security and the latest in malware
& threats.
& _______________________________________________
& Samtools-help mailing list
& Samtools-help@...
Joseph Fass
Lead Data Analyst
UC Davis Bioinformatics Core
joseph.fass -at-
530.752.2698 (w)
Hello everybody,
BWA seems to have introduced a bug in version 0.6.1
This is how I get it shown:
/bwa-0.6.1/bwa bwasw -t 4 mouse.mm9.fasta myfile.fq.gz & myfile.sai
[bwt_restore_sa] SA-BWT inconsistency: seq_len is not the same. Abort!
I am currently running successfully the exact same command with version 0.5.9.
I interpret the error message as saying that the input sequences have
different lengths. I checked, all sequences are 76 nucleotides long.
Am I the only one seeing this?
Thank you,
Ivan Gregoretti, PhD
does vcfutils.pl contain opinions to filtered out snps clustered in 10 bp windows,I want to get only SNPs at least 10 bp apart.
It seems that the default region extraction function of samtools does
not preserve the pairness of the reads. I could sort the reads based
on the name myself. But is there a more standard way to extract paired
reads from a given region?
samtools view -b -o "$outfile" "$f" "${region[@]}"
On the same note I also have a question regarding the order of genotypes.
For the following VCF line:
chr1 3190789 . A C,X 25 .
DP=3;VDB=0.0371;AF1=0.5;CI95=0.5,0.5;DP4=0,0,2,1;MQ=60 PL:DP:GT:GQ
64,9,0,64,9,64:3:0/1:55
What is the order of genotypes that the PL values refers to?
I guess that at least the third genotype (with PL=0) is AC as the GT field
is 0/1, but what about the rest?
Thanks a lot,
On Thu, Apr 26, 2012 at 2:56 PM, Heng Li &lh3@...& wrote:
& Yes, Petr is correct. I just want to add a little more context. In your
& example, we cannot assume the reference "T" is the only allele only because
& we do not see other alleles. We need to keep the likelihoods of all
& possible allele combinations: T/T, T/A, T/C, T/G, A/A, … However, when you
& write down the 10 likelihoods, you will find that it is highly repetitive
& and has a pattern. You can actually use an allele "X", unobserved allele,
& to keep those likelihoods in a compact way. This is where "X" comes from.
& On Apr 26, 2012, at 2:43 PM, Petr Danecek wrote:
& & Hi Eric,
& & X stands for alleles other than listed in REF or ALT, so here it stands
& & for "non-T"
& & On Thu,
at 12:29 -0400, Eric Liu wrote:
& && I have a question about BCF format. When the 'ALT' field is 'X', I do
& && not know why the 'PL' field has three values and what genotype it
& && stands for? For example,
& DP=45;I16=27,13,0,0,,0,0,216,,369, 0,45,46:15
& && Thanks.
& ------------------------------------------------------------------------------
& && Live Security Virtual Conference
& && Exclusive live event will cover all the ways today's security and
& && threat landscape has changed and how IT managers can respond.
& Discussions
& && will include endpoint security, mobile security and the latest in
& && threats.
& && _______________________________________________ Samtools-help mailing
& list Samtools-help@...
& & The Wellcome Trust Sanger Institute is operated by Genome Research
& & Limited, a charity registered in England with number 1021457 and a
& & company registered in England with number 2742969, whose registered
& & office is 215 Euston Road, London, NW1 2BE.
& ------------------------------------------------------------------------------
& & Live Security Virtual Conference
& & Exclusive live event will cover all the ways today's security and
& & threat landscape has changed and how IT managers can respond. Discussions
& & will include endpoint security, mobile security and the latest in malware
& & threats.
& & _______________________________________________
& & Samtools-help mailing list
& & Samtools-help@...
The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.
& ------------------------------------------------------------------------------
& Live Security Virtual Conference
& Exclusive live event will cover all the ways today's security and
& threat landscape has changed and how IT managers can respond. Discussions
& will include endpoint security, mobile security and the latest in malware
& threats.
& _______________________________________________
& Samtools-help mailing list
& Samtools-help@...
Yes, Petr is correct. I just want to add a little more context. In your example, we cannot assume the reference "T" is the only allele only because we do not see other alleles. We need to keep the likelihoods of all possible allele combinations: T/T, T/A, T/C, T/G, A/A, … However, when you write down the 10 likelihoods, you will find that it is highly repetitive and has a pattern. You can actually use an allele "X", unobserved allele, to keep those likelihoods in a compact way. This is where "X" comes from.
On Apr 26, 2012, at 2:43 PM, Petr Danecek wrote:
& Hi Eric,
& X stands for alleles other than listed in REF or ALT, so here it stands
& for "non-T"
at 12:29 -0400, Eric Liu wrote:
&& I have a question about BCF format. When the 'ALT' field is 'X', I do
&& not know why the 'PL' field has three values and what genotype it
&& stands for? For example,
. T X . DP=45;I16=27,13,0,0,,0,0,216,,369, 0,45,46:15
&& Thanks.
&& ------------------------------------------------------------------------------
&& Live Security Virtual Conference
&& Exclusive live event will cover all the ways today's security and
&& threat landscape has changed and how IT managers can respond. Discussions
&& will include endpoint security, mobile security and the latest in malware
&& threats.
&& _______________________________________________ Samtools-help mailing list Samtools-help@...
& The Wellcome Trust Sanger Institute is operated by Genome Research
& Limited, a charity registered in England with number 1021457 and a
& company registered in England with number 2742969, whose registered
& office is 215 Euston Road, London, NW1 2BE.
& ------------------------------------------------------------------------------
& Live Security Virtual Conference
& Exclusive live event will cover all the ways today's security and
& threat landscape has changed and how IT managers can respond. Discussions
& will include endpoint security, mobile security and the latest in malware
& threats.
& _______________________________________________
& Samtools-help mailing list
& Samtools-help@...
The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.
X stands for alleles other than listed in REF or ALT, so here it stands
for "non-T"
at 12:29 -0400, Eric Liu wrote:
& I have a question about BCF format. When the 'ALT' field is 'X', I do
& not know why the 'PL' field has three values and what genotype it
& stands for? For example,
. T X . DP=45;I16=27,13,0,0,,0,0,216,,369, 0,45,46:15
& ------------------------------------------------------------------------------
& Live Security Virtual Conference
& Exclusive live event will cover all the ways today's security and
& threat landscape has changed and how IT managers can respond. Discussions
& will include endpoint security, mobile security and the latest in malware
& threats.
& _______________________________________________ Samtools-help mailing list Samtools-help@...
The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.
On Thu, Apr 26, 2012 at 6:52 PM,
&bzguan@...& wrote:
& Is it possible to further compress bam files?
What software
& would you recommend I used to compress the bam files?
& Thanks in advance for your help.
Yes, but it may not be sensible (except perhaps for archiving).
For instance you can do reference based compression in BAM:
Also in terms of lossy option you can drop some of the tags
(e.g. old sequence and quality if the base calls were revised),
or reduce the range of quality scores held.
These and other ideas are being applied in CRAM, which may
replace BAM in the future, but is still in active development at
the moment:
results of 173
(Page 1 of 7)